Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Bartonella henselae

The B. henselae MLST scheme uses internal fragments of the following seven house-keeping genes and 16s loci:

PCR Amplification of genes from isolates

The primer pairs used for the PCR amplification of internal fragments of these genes are:

geneproduct size (bp)forward primerreverse primer
16S rDNA472AGAGTTTGATCCTGGYTCAGCTTTACGCCCARTAAWTCCG
batR487GACCGCAATATTTTGACATCGCATCCATCAAAGCATCACGACTT
ribC283AGCGAGGATCAAAACAACGCTCTTCAACACAATTAACG
groEL369GTTGATGATGCCTTGAACTGGTGTGTCTTTCTTTGG
gltA338GGGGACCAGCTCATGGTGGAATGCAAAAAGAACAGTAAACA
nlpD494GGCGCTGGTATGATACAAGACATCTGTGCGGAAGAA
ftsZ483GCCTTCTCATCCTCAACTTCCTTTGTTTTAAACGCTGCC
rpoB471CTGGACGTACATCCTACAAACAGCAGCTCCTGAATC

PCR Conditions for MLST housekeeping genes

Amplification of each of the MLST housekeeping genes from isolates is carried out using a single round PCR assay that amplifies a fragment of each of the loci in the table above. Each reaction mixture comprised 12.5 µl of 2x PCR mastermix (Abgene), 0.5 µl of a 20 ρmol/μl solution of both forward and reverse primers, 10.5 µl sterile, distilled water and 1 µl of bacterial cell suspension. Reaction mixtures are exposed to a thermal cycle consisting of 96°C for 5 min followed by 40 cycles of 96 °C for 10 s, 55 °C for 10 s and 72 °C for 50 s, with a final extension step of 72 °C for 10 min.

Due to the difficulty in obtaining isolates of B. henselae from humans, alternative primers have been suggested in the table below for use in the first round of a nested PCR to allow amplification of the loci from human clinical DNA extracts. The second round primers are the primers from the original B. henselae MLST scheme. Reaction mixes and thermal cycling conditions are the same as those described above, with 1 µl of 1st round post-amplification PCR mix being incorporated as template into a second round reaction mix.

genenested PCR roundforward primerreverse primer
16S rDNA1stCAATATGAGAGTTTGATCCTGACCTCTGACTTAAATATCCG
2ndAGAGTTTGATCCTGGYTCAGCTTTACGCCCARTAAWTCCG
batR1stCGATTGTACTTGTTGATGATGATGTACAGGTGTGACGTTCTT
2ndGACCGCAATATTTTGACATCGCATCCATCAAAGCATCACGACTT
ribC1stGTGTTCAGGAGTTTGTCTAAGGCGAATAATAAGAACATCG
2ndAGCGAGGATCAAAACAACGCTCTTCAACACAATTAACG
nlpD1stGGATTCTCCAACATTGTCATCTTTATTCATCACGGTATC
2ndGGCGCTGGTATGATACAAGACATCTGTGCGGAAGAA
groEL1stGCAACAGAAGTTGAAGTGAAAGGCACTGGTGTGTCTTTCT
2ndGTTGATGATGCCTTGAACTGGTGTGTCTTTCTTTGG
gltA1stTCAGGTGCTAATCCATTTGCAATTTCTTTCCATTGCGCAAC
2ndGGGGACCAGCTCATGGTGGAATGCAAAAAGAACAGTAAACA
ftsZ1stTCGTGAGGTTAGTGATTTAGCCTCTTCACGATGTGTCAAA
2ndGCCTTCTCATCCTCAACTTCCTTTGTTTTAAACGCTGCC
rpoB1stAAATTACCCATAAGCGGCGTATCAACAATACCACTACGCCT
2ndCTGGACGTACATCCTACAAACAGCAGCTCCTGAATC

Sequencing

The same primer pairs as used for amplification (or the second round of amplification when nested PCRs are employed are also used for sequencing.

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Bartonella henselae MLST website (http://pubmlst.org/ bhenselae/) sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 25
Profiles (MLST): 32
Last updated: 2016-02-03

Isolate database
Isolates: 434
Last updated: 2016-02-04