Expand PubMLST Databases Downloads BIGSdb Contact Site map

Corynebacterium diphtheriae MLST Protocol

Genes

The Corynebacterium diphtheriae MLST scheme uses fragments of the following seven house-keeping genes:

ATP synthase alpha chain (atpA)
DNA polymerase III alpha subunit (dnaE)
Chaperone protein (dnaK)
Elongation factor G (fusA)
2-isopropylmalate synthase (leuA)
2-oxoglutarate dehydrogenase E1 and E2 components (odhA)
DNA-directed RNA polymerase beta chain (rpoB)

PCR amplification

Reaction conditions for all the primers were as follows: initial denaturation at 96°C for 1 min; 35 cycles of denaturation at 96°C for 1 min, primer annealing at 58°C for 1 min, extension at 72°C for 2 min; followed by a final extension step of 72°C for 5 min. Each 25 µl amplification reaction mixture comprised: 5 µl Q solution (Qiagen), 3.0 µl chromosomal DNA (5-20 ng/µl), 1.0 µl forward primer (10 pmol/µl), 1.0 µl reverse primer (10 pmol/µl), 5.0 µl 10x PCR buffer (Qiagen, contains 15 mM MgCl2), 0.5 µl dNTP solution (Qiagen, 10 mM each dNTP), 0.125 µl Taq polymerase (Qiagen, 5units/µl), 0.5 µl of MgCl2 (25mM) and 25.75 µl PCR-grade water. All Qiagen solutions from PCR CORE Kit (Cat No. 201225). The amplification product was then purified using MinElute UF plates (Qiagen) following the manufacturers protocol before being used in a sequencing reaction. Sequencing was carried out on each DNA strand with BigDye Terminator Ready Reaction Mix v3.1 (PE Biosystems, Foster City, US) under standard sequencing conditions according to the manufacturer's protocol. Unincorporated dye terminators were removed by precipitation with 95% alcohol. The reaction products were separated and detected on an ABI PRISM genetic analyser 3100 (PE Biosystems) using a standard sequencing module with a Performance Optimised Polymer and 5 cm array. The primers used in MLST analysis of C. diphtheriae are listed below. Note the rpoB sequencing primers were described by Khamis et al 2004, J Clin Microbiol 42:3925-3931.

GeneDirectionPrimer Sequence
atpAFGCGATTGCGAACTACACC
RCTCGAGGAATACCTRACC
dnaEFTGCGTCATCTGATTGAAA
RCGGTCCAATAAGACACCA
dnaKFACTTGGGTGGCGGTACTT
RTGGTGAACGTCTCGGAAC
fusAFTACCGCGAGAAGCTCGTT
RGAAGGTTGGGTCCTCTTC
leuAFCGTGCACTTCTACAACTC
RACCGTGATCGGTCTTCAT
odhAFCGGCAAGGAAASCATGAC
RGTTGTCGCCRAACATCTG
rpoBFAAGCGCAAGATCCAGGAC
RTCGAACTCGTCGTCATCC

Sequencing

GeneDirectionPrimer SequenceAllele size (bp)
atpAFAGAAGGCGACGAAGTMAAGC378
RCRGAATCAGAAGCTGGWGCA
dnaEFGTGCGACAAGCTGGTGTG354
RGGCTTWCGGCCATTYTTG
dnaKFAGATGGCTATGCAGCGTCT345
RGATGAGCTTGGTCATCACG
fusAFCGTAAGCTGACCGTTAACTC360
RCCATGGACTCRAGGATGA
leuAFCCYATCATCATCAAYCTGCC384
RCAGCTGGTTGCAGTAYTC
odhAFTBCAAGATCGCATYGARRC381
RTWGGCTCGATGTGKCCTTC
rpoBFCGWATGAACATYGGBCAGGT342
RTCCATYTCRCCRAARCGCTG

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Corynebacterium diphtheriae MLST website (http://pubmlst.org/ cdiphtheriae/) developed by Keith Jolley and sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 397
Profiles (MLST): 386
Last updated: 2016-05-26

Isolate database
Isolates: 534
Last updated: 2016-06-08