Primers and PCR conditions for MLST of P. multocida

The primers and the PCR conditions used in the establishment of this MLST scheme are presented below. PCR conditions may need to be modified for use in other laboratories. Since the same primers are used for the initial amplification, and for sequencing, it is important that PCR conditions are used which result in the amplification of the desired single fragment. This may involve some optimisation of the annealing temperature.

House keeping genes utilized in the scheme and the fragment size of the amplified products:

adk (Adenylate kinase)570 bp
est (Esterase)641 bp
pmi (Mannose-6-Phosphate Isomerase)739 bp
zwf (Glucose-6-Phosphate Dehydrogenase)808 bp & 614 bp
mdh (Malate Dehydrogenase)620 bp
gdh (Glutamate dehydrogenase)702 bp
pgi (Phospho Glucose Isomerase)784 bp

Primer sets designed for the amplification and sequencing of seven P. multocida housekeeping genes.

GenePrimer Sequence (5' to 3')Amplicon Size (bp)
ForwardReverse
adkTTTTTCGTCCCGTCTAAGCGGGGAAAGGGACACAAGC570
estTCTGGCAAAAGATGTTGTCGCCAAATTCTTGGTTGGTTGG641
pmiTGCCTTGAGACAGGGTAAGCGCCTTAACAAGTCCCATTCG739
zwf-1AATCGGTCGTTTGACTGAGCTGCTTCACCTTCAACTGTGC808
mdhATTTCGGGATCAGGGTTAGCGGAAAACCGGTAATGGAAGG620
gdhATCGACTTCTTCCGCAGACCGCGGGTGATATTGGTGTAGG702
pgiACCACGCTATTTTTGGTTGCATGGCACAACCTCTTTCACC784
zwf-2 *TGTTAGGTGTGGCAAGAACGTTGCAACAAATGGTTTTGGA614

*The primer set zwf-2 is only used if the first primer set (zwf-1) fails to amplify the desired product.

Initially, six isolates of P. multocida were chosen randomly to determine that each primer set could produce a single amplicon. PCR reactions over a range of annealing temperatures were performed in order to determine the optimal Tm for each primer set.

The 50 µl PCR reaction mixture contained 1.5 mM MgCl2, 50 mM KCl and 10 mM Tris HCl (pH 8.3) in the buffer, 200 µM of each dNTP (dATP, dCTP, dGTP, dTTP), 0.4 µM of each primer and 1.25 units Taq DNA polymerase (Boehringer Mannheim, Mannheim, Germany). Two µl of genomic DNA was used as template.

Master mix for 50 µl reaction

ReagentsVolume (µl)Notes
H2O30.0
10x reaction buffer5.01.5 mM MgCl2
PCR primer 12.010 µM Primer stock = 0.4 µM Final concentration
PCR primer 22.010 µM Primer stock = 0.4 µM Final concentration
dNTP mix8.01.25 mM stock = 200 µM final concentration of each nucleotide
Taq polymerase1.01.25 units per reaction
Total48.0

Mix well by votexing and then spot spin and aliquot 48 µl into each PCR tube. Then add 2 µl of respective DNA to each tube.

dNTPs

dATP, dCTP, dGTP, dTTP
We used Boehringer Mannheim (Roche) (Cat # 1277049) dNTPs which are 100 mM. A stock solution containing 1.25 mM of each dNTP by adding 5 µl of each dNTP to 380 µl DNA-grade H2O was prepared. Using 16 µl of this stock solution in a 100 µl reaction volume or 8 µl in a 50 µl reaction volume gives 200 µM final concentration of each nucleotide.

A 4 µl aliquot of the PCR product was mixed with 1 µl loading buffer and then run in 2% DNA-grade agarose gel containing ethidium bromide (1 µl/µg) in 1%TAE buffer at 80 V for about 40 minutes and visualised under UV light. Ready-load 100 bp DNA ladder (Invitrogen 10380-012) was used in all gels to determine fragment size.

PCR cycle parameters

STEP 1:94 °C5 minutes (Initial Denaturation)
STEP 2:94 °C30 seconds (Denaturation)
48 °C30 seconds (Annealing)
72 °C1 minute (Extension)
STEP 3:Repeat STEP 2 into 30 cycles
STEP 4:72 °C5 minutes
STEP 5:Hold at 4 °C

PCR product clean-up

Each PCR reaction is done in duplicates.

Sequencing reaction

Purified product (100 ng/µl)= 4 µl
Primer (25 ng/µl) = 1 µl
BDT 3.1 = 4 µl
BDT Buffer/ H2O= 1 µl
Total volume= 10 µl

NOTE: The amount of purified product often varies depending on the product concentration. So when less than 4 µl template is used buffer or water will be adjusted to give final volume 10 µl.

Sequencing cycle parameters

Step-194 °C for 5minutes (Denaturation)
Step-2 96 °C for 10 seconds
50 °C for 5 seconds (Annealing)
60 °C for 4 minutes (Extension)
Step-3Repeat Step-2 into 30 cycles
Step-4Hold at 4 °C

Navigation

- PubMLST+ PubMLST
MLST Home
Search / site map
Download data
Databases
News
- Software+ Software
Web tools
Software
- Recently updated+ Recently updated
A. baumannii
A. fumigatus
Arcobacter
B. cepacia
B. cereus
B. hyodysenteriae
B. intermedia
B. pilosicoli
Bordetella
Brachyspira
C. difficile
C. diphtheriae
C. helveticus
C. insulaenigrae
C. jejuni
C. lari
C. tropicalis
C. upsaliensis
Cronobacter
H. parasuis
H. pylori
M. agalactiae
Neisseria
P. acnes
P. aeruginosa
P. multocida (RIRDC)
S. agalactiae
S. zooepidemicus
V. parahaemolyticus
V. vulnificus
Wolbachia
X. fastidiosa
- Mirrors+ Mirrors
About our mirrors Primary | UK2 | UK3 | US1
- Developers+ Developers
SOAP API

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the avian Pasteurella multocida MLST website (http://pubmlst.org/ pmultocida/) developed by Keith Jolley and sited at the University of Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). The development of this site has been funded by the Wellcome Trust.

Status

Profile database

Profiles: 267
Last updated: 2012-05-03

Isolate database

Isolates: 538
Last updated: 2011-12-19