Expand PubMLST Databases Downloads BIGSdb Contact Site map

PCR for Staphylococcus epidermidis MLST

Internal fragments of the seven loci can be amplified by PCR, using the primers listed below and chromosomal DNA as a template. PCR involved an initial denaturation of 95 °C for 3 min; 34 cycles of 95 °C for 30 s, 50 °C for 1 min, and 72 °C for 1 min; and a final extension of 72 °C for 10 min.

Gene and functionPrimerSequences (5'-3')Size of amplicon used for assigning alleles
Carbamate Kinase (arcC)arcC-FTGTGATGAGCACGCTACCGTTAG465
arcC-RTCCAAGTAAACCCATCGGTCTG
Shikimate dehydrogenase (aroE)aroE-FCATTGGATTACCTCTTTGTTCAGC420
aroE-RCAAGCGAAATCTGTTGGGG
ABC transporter (gtr)gtr-FCAGCCAATTCTTTTATGACTTTT438
gtr-RGTGATTAAAGGTATTGATTTGAAT
DNA mismatch repair protein (mutS)mutS-F3GATATAAGAATAAGGGTTGTGAA412
mutS-R3GTAATCGTCTCAGTTATCATGTT
Pyrimidine operon regulatory protein (pyrR)pyr-F2GTTACTAATACTTTTGCTGTGTTT428
pyr-R4GTAGAATGTAAAGAGACTAAAATGAA
Triosephosphate isomerase (tpiA)tpi-F2ATCCAATTAGACGCTTTAGTAAC424
tpi-R2TTAATGATGCGCCACCTACA
Acetyl coenzyme A acetyltransferase (yqiL)yqiL-F2CACGCATAGTATTAGCTGAAG416
yqiL-R2CTAATGCCTTCATCTTGAGAAATAA

Sequences for each locus must be obtained for both the forward and reverse strands, and must be 100% accurate, since even a single error will alter the allelic number obtained.

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Staphylococcus epidermidis MLST website (http://pubmlst.org/ sepidermidis/) sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 343
Profiles (MLST): 607
Last updated: 2016-02-26

Isolate database
Isolates: 1056
Last updated: 2016-02-26