Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers and PCR conditions for MLST of Streptococcus suis

Internal fragments of the 5-enolpyruvylshikimate 3-phosphate synthase (aroA), 60 KDa chaperonin (cpn60), peroxide resistance (dpr), glucose kinase (gki), DNA mismatch repair protein (mutS), homologous recombination factor (recA) and aspartokinase (thrA) genes were amplified by PCR using the following primer pairs.

aroA-up 5’ TTCCATGTGCTTGAGTCGCTA 3’ and
aroA-dn 5’ ACGTGACCTACCTCCGTTGAC 3’

cpn-up 5’ TTGAAAAACGTRACKGCAGGTGC 3’and
cpn-dn 5’ ACGTTGAAIGTACCACGAATC 3’

dpr-up 5’ CGTCTTTCAGCCCGCGTCCA 3’ and
dpr-dn 5’ GACCAAGTTCTGCCTGCAGC 3’

gki-up 5’ GGAGCCTATAACCTCAACTGG 3’ and
gki-dn 5’ AAGAACGATGTAGGCAGGATT 3’

mutS-up 5’ CGCAGAGCAGATGGAAGATCC 3’ and
mutS-dn 5’ CCCATAGCTGTTTTGGTTTCATC 3’

recA-up 5’ TATGATGAGTCAGGCCATG 3’ and
recA-dn 5’ CGCTTAGCATTTTCAGAACC 3’

thrA-up 5’ GATTCAGAACGTCGCTTTGT 3’ and
thrA-dn 5’ AAGTTTTCATAGAGGTCAGC 3’

The primer

5’ AAGAATGGATCATCAACCGT 3’

was used for the forward thrA sequencing reaction.

PCR reactions are performed in 50 µl volumes using 30 cycles of 95 °C for 1 min, X °C for 1 min. (where X is 55 °C for aroA and gki, 52 °C for cpn and thrA, and 50 °C for dpr, mutS and recA) and 72 °C for 1 min. PCR products are purified through Qiagen PCR purification kits and the sequence of each fragment is obtained on both strands using the same primers as those used in the initial PCR with the exception of thrA as described above.

The development of the initial Streptococcus suis MLST database is described in the following publication:

King, S.J., Leigh, J.A., Heath, P.J., Luque, I., Tarradas, C., Dowson, C.G., and Whatmore, A.M. 2002. Development of a multilocus sequence typing scheme for Streptococcus suis: Identification of virulent clones and potential capsular serotype exchange. J Clin Microbiol 40:3671-3680.

The Streptococcus suis MLST database was developed by Sam King and Adrian Whatmore at the University of Warwick. We gratefully acknowledge the many co-workers who contributed strains for the pilot study (A. Cheng, B. Francois, M. Gottschalk, G. Grise, P. Heath, C. Lammler, I. Luque and P. Norton) and the financial support of the BBSRC (Grant 88/S11598) and The Wellcome Trust (Grant 053589).

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Streptococcus suis MLST website (http://pubmlst.org/ ssuis/) sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 1648
Profiles (MLST): 770
Last updated: 2016-06-14

Isolate database
Isolates: 1602
Last updated: 2016-06-14